返回
返回
返回
EZ Trans One-Step Lentivirus Packaging Kit
One click copying of product information
-
AC04L6055T1280
-
AC04L61010T2280
-
AC04L62020T3980
- Product Description
- Product FAQ
- COA
- Product Literature
- MSDS
- Operation video
-
Product Description
Li Ji Bio’s EZ Trans One‑Stop Lentiviral Infection Kit includes all the essential components—lentiviral packaging plasmid complexes, control plasmids, the transfection reagent (EZ Trans Regent), lentiviral concentrate, and a lentiviral infection enhancer—enabling efficient, end‑to‑end execution of the entire process, from viral packaging to cell infection. The Li Ji Bio Lentiviral Infection Kit provides ample, high‑quality control and packaging plasmids, eliminating the need for researchers to isolate plasmids and allowing for rapid packaging and subsequent infection of target cells.
The Li Ji Bio lentiviral vector expression system consists of the pLenti lentiviral vector and the Lentiviral Mix plasmid. The pLenti vector contains the HIV‑derived 5′ LTR and 3′ LTR, along with additional regulatory elements such as WPRE. Its expression cassette comprises U6‑shRNA(NC)‑CMV‑EGFP‑2A‑Puro, encoding green fluorescence and a puromycin resistance gene for eukaryotic selection. The Lentiviral Mix plasmid provides all the essential components required for viral packaging and is compatible with both second‑ and third‑generation lentiviral packaging systems.
Product ingredients
Component
AC04L605 (5T)
AC04L610 (10T)
AC04L620 (20T)
A. Reference plasmid
16 μL
32 μL
64 μL
B. Packaging plasmid complex
110 μL
220 μL
440 μL
C. Transfection reagent
450 μL
900 μL
1800 μL
D. Infection enhancer
60 μL
120 μL
240 μL
E. Lentivirus Concentrate
12.5mL
25mL
50mL
Mode of transportation
Blue ice transport. Components A, B, and D should be stored at −20°C, while components C and E should be stored at 4°C; the shelf life is 12 months.
Sample Information
Clone Serial Number:
GL427NC2
Sequence Name:
ShRNA(NC)
Species:
NC
Upstream and downstream cloning restriction enzyme sites
AgeI
EcoRI
Prokaryotic resistance:
Amp
Post-build name:
pSLenti-U6-shRNA(NC2)-CMV-EGFP-F2A-Puro-WPRE
Forward sequencing primer:
7#hU6-F2 TACGATACAAGGCTGTTAGAGAG
Reverse sequencing primer:
8#pY-SEQR CTATTAATAACTAATGCATGGC
Other Notes
Knowledge graph
This product is intended solely for scientific research and must not be used for clinical diagnosis, treatment, or any other purposes.
-
Q: If I accidentally left the plasmid at 4°C, can it still be used?
A: Li Ji Bio’s plasmids are highly stable; they remain intact for about two weeks at 4°C. For long-term storage, we recommend keeping them at −20°C or −80°C.
Q: What is the concentration of the plasmid? Do I still need to remove endotoxins?
A: Li Ji Bio provides plasmid at a concentration of 1 µg/µL, so customers do not need to remove endotoxins themselves.
Q: If you believe the provided plasmid concentration is insufficient, can you perform another transformation yourself? Which antibiotic resistance should you use?
A: It can be converted again on its own, conferring Amp resistance.
Q: Can the EZ Trans one-stop lentiviral packaging kit be used to package either knockdown expression plasmids or overexpression plasmids?
A: The EZ Trans one‑step lentiviral packaging kit is intended solely for packaging interference expression plasmids. These plasmids are driven by the U6 promoter and lack a eukaryotic translation initiation ATG, a Kozak sequence, and a polyadenylation signal, resulting in transcription of only small RNAs.
-
Fill in the product batch number for inquiry
-
Fill in the product batch number for inquiry
Best Sellers
Popular Articles
Group Website
-
Contact Information
Landline phone:021-50778506
Business Manager:18616108315Business Cooperation/Scholarships:18616108697
Address:4th Floor, Building 27, Lane 908, Ziping Road, International Medical Park, Pudong New Area, Shanghai
Email:ztt0005@obiosh.com
WeChat Official Account
Online Customer Service 1
Online Customer Service 2
Telephone consultation
